Home | Impressum | Sitemap | KIT

CRISPR/Cas Plasmids & Protocols for Genome Engineering in Plants

sgRNA cloning
sgRNA cloning

Overview

We demonstrated that:

  • Heritable targeted mutagenesis events can be induced using the Cas9 nuclease.
  • Heritable targeted mutagenesis events can be induced using two paired Cas9 nickases. A paired nickase approach may avoid potential off-target effects in loci with strong sequence homologies to the original target site.
  • Heritable gene targeting events can be achieved by combining the CRISPR/Cas system with our previously developed in planta gene targeting technology (Fauser et al., 2012).
  • The Cas9 nickase (D10A) is able to induce homologous recombination at high efficiencies.
  • Cas9 orthologues from S. aureus and S. thermophilus also induce heritable targeted mutagenesis at high frequencies. Cas9 enzymes and sgRNAs are highly specific, thus, the different orthologues can be used to fulfill different enzymatic functions simultaneously.

 

Publications:

 

Reviews:

 

Protocols:

Cloning Protocol

Here, we describe our Gateway-compatible cloning protocol for single sgRNAs. To obtain any of the available plasmids or if there are questions about the procedure, please contact us directly.

 

  1. Preparations
    • Pick your 20-nt protospacer sequence. For detailed information refer to the respective orthologue you are using.
    • Order desalted oligos:
      • FW: 5'-ATTG + protospacer
      • REV: 5'-AAAC + rev-com protospacer
         
  2. Oligo annealing
    • 2 µl of each oligo (50 µM) + 46 µl ddH20
    • Incubate for 5 min, 95°C (thermocycler, no cooling at the end!)
    • Cooling at RT for 20 min
       
  3. Digest entry vector
    • 10 µl pEn-Chimera
      2 µl 10x NEB buffer 2.1
      1 µl NEB BbsI (stored at -80°C!)
      7 µl ddH2O
    • Incubate for >1 h, 37°C
    • Purify
    • Adjust to 5 ng/µl
       
  4. Ligation
    • 2 µl of digested pEn-Chimera
      3 µl of annealed oligos
      1 µl of T4 Ligase
      5 µl of NEB 2x Quick Ligase Buffer (or any other T4 buffer)
    • Incubate for 1h, RT
    • Transform 5 µl in NEB5alpha, plate 100 µl on LB/Amp
       
  5. Colony-PCR
    • Test 5 colonies (efficiency >70%)
    • Use fw-oligo + SS129 as primers
    • Anneal at 56°C, 30 s elongation, 30 cycles
    • Expected band at 370 bp
       
  6. Miniprep
    • Sequence using primer SS42
    • Adjust to 100 ng/µl
       
  7. Gateway Reaction
    • 2 µl of your entry vector
      3 µl of respective CAS9 vector (adjust to 50 ng/µl)
      4 µl TE buffer, pH 8
      1 µl LR clonase II
    • Vortex + centrifuge
    • Incubate for >2 h, RT
    • Proteinase K treatment: add 1 µl; incubate for 10 min, 37°C (crucial step!)
    • Transform completely in NEB5alpha, plate 100 µl on LB/Spec
       
  8. Optional: Colony-PCR
    • All colonies should be OK, test 3-6
    • Use primers SS42 / SS43
    • Anneal at 60°C, 1 min elongation, 35 cycles
    • Expected band at 1070 bp
    • For vectors with Kanamycin plant selection:
      • Use primers SS42 / SS 102
      • Anneal at 60 °C, 1 min elongation, 35 cycles
      • Expected band at 917 bp
         
  9. Miniprep
    • Control by digestion using AflII and NheI
      • Expected bands (nuclease): 5.9 kb, 5.0 kb and 3.8 kb
    • Optional: Sequence using SS42 and SS61
       
  10. Primer Sequences
    • SS42: TCCCAGGATTAGAATGATTAGG
    • SS43: CGACTAAGGGTTTCTTATATGC
    • SS61: GAGCTCCAGGCCTCCCAGCTTTCG
    • SS129 (M13): CACAGGAAACAGCTATGAC
    • SS102 CACCATGTTATCACATCAATCC


Plasmids

We are happy to share all of our CRISPR/Cas reagents with the plant community. Please feel free to contact us directly if you are interested in any of our reagents. If you are interessted in our plasmids concerning the different Cas9 othologs you can find them in our special sections here: S.pyogenes, S.aureus, S.thermophilus