Botanisches Institut

CRISPR/Cas Plasmids & Protocols for Genome Engineering in Plants

Overview

We demonstrated that:

  • Heritable targeted mutagenesis events can be induced using the SpyCas9, SauCas9 and SthCas9 nucleases
  • LbCas12 can be engineered for highly efficient temperature-tolerant plant gene editing (ttLbCas12)
  • Tandem duplications can be induced by using paired SpyCas9 nickases
  • Heritable homologous recombination based gene targeting events can be achieved by combining the SpyCas9 with our previously developed in planta gene targeting technology
  • In planta gene targeting can be further improved  by using egg-cell specific expression of SauCas9 or ttLbCas12a
  • Catalytic inactive versions of the SauCas9 nuclease and and SpyCas9 fused to fluorescent proteins can be  used for live cell imaging of telomeric regions in plants
  • Heritable chromosomal inversion can be induced efficiently by using egg-cell specific expression of the SauCas9 nuclease
  • Heritable chromosomal translocations can be induced efficiently by using egg-cell specific expression of the SauCas9 nuclease

 

Publications:

 

Recent Reviews:

 

Protocols:

 

Cloning Protocol

Here, we describe our Gateway-compatible cloning protocol for single sgRNAs. To obtain any of the available plasmids or if there are questions about the procedure, please contact us directly.

 

  1. Preparations
    • Pick your 20-nt protospacer sequence. For detailed information refer to the respective orthologue you are using.
    • Order desalted oligos:
      • FW: 5'-ATTG + protospacer
      • REV: 5'-AAAC + rev-com protospacer
         
  2. Oligo annealing
    • 2 µl of each oligo (50 µM) + 46 µl ddH20
    • Incubate for 5 min, 95°C (thermocycler, no cooling at the end!)
    • Cooling at RT for 20 min
       
  3. Digest entry vector
    • 10 µl pEn-Chimera
      2 µl 10x NEB buffer 2.1
      1 µl NEB BbsI (stored at -80°C!)
      7 µl ddH2O
    • Incubate for >1 h, 37°C
    • Purify
    • Adjust to 5 ng/µl
       
  4. Ligation
    • 2 µl of digested pEn-Chimera
      3 µl of annealed oligos
      1 µl of T4 Ligase
      5 µl of NEB 2x Quick Ligase Buffer (or any other T4 buffer)
    • Incubate for 1h, RT
    • Transform 5 µl in NEB5alpha, plate 100 µl on LB/Amp
       
  5. Colony-PCR
    • Test 5 colonies (efficiency >70%)
    • Use fw-oligo + SS129 as primers
    • Anneal at 56°C, 30 s elongation, 30 cycles
    • Expected band at 370 bp
       
  6. Miniprep
    • Sequence using primer SS42
    • Adjust to 100 ng/µl
       
  7. Gateway Reaction
    • 2 µl of your entry vector
      3 µl of respective CAS9 vector (adjust to 50 ng/µl)
      4 µl TE buffer, pH 8
      1 µl LR clonase II
    • Vortex + centrifuge
    • Incubate for >2 h, RT
    • Proteinase K treatment: add 1 µl; incubate for 10 min, 37°C (crucial step!)
    • Transform completely in NEB5alpha, plate 100 µl on LB/Spec
       
  8. Optional: Colony-PCR
    • All colonies should be OK, test 3-6
    • Use primers SS42 / SS43
    • Anneal at 60°C, 1 min elongation, 35 cycles
    • Expected band at 1070 bp
    • For vectors with Kanamycin plant selection:
      • Use primers SS42 / SS 102
      • Anneal at 60 °C, 1 min elongation, 35 cycles
      • Expected band at 917 bp
         
  9. Miniprep
    • Control by digestion using AflII and NheI
      • Expected bands (nuclease): 5.9 kb, 5.0 kb and 3.8 kb
    • Optional: Sequence using SS42 and SS61
       
  10. Primer Sequences
    • SS42: TCCCAGGATTAGAATGATTAGG
    • SS43: CGACTAAGGGTTTCTTATATGC
    • SS61: GAGCTCCAGGCCTCCCAGCTTTCG
    • SS129 (M13): CACAGGAAACAGCTATGAC
    • SS102 CACCATGTTATCACATCAATCC


Plasmids

We are happy to share all of our CRISPR/Cas reagents with the plant community. Please feel free to contact us directly if you are interested in any of our reagents. If you are interessted in our plasmids concerning the different Cas9 othologs and Cas12a you can find them in our special sections here: LbCas12a, S.pyogenes, S.aureus, S.thermophilus